Produksi Imunoglobulin Y Anti?COMD Streptococcus Mutans sebagai Anti?Plak Gigi dengan Menggunakan Teknologi Vaksin DNA


Staff : Endang W. Bachtiar
Students : ‐
Sponsors : DIKTI‐Insentif 2007
Email contact : endang04@ui.edu

Introduction:
The aim of the study is to costruct an anti‐caries DNA vaccine harboring a main virulence genes from caries pathogen Streptococcus mutans (S. mutans). Methodology: The gene encoding a quorum sensing molecule (Com‐D) was amplified from genomic DNA from S. mutans by PCR, using primers: ComD‐F: 5’ggatccatgaatgaagccttaatgat 3’ and ComD‐R: 5’ggatcctattttattattaggagttgc 3’. Then the PCR product was digested with BamH1 and cloned into the plasmid pCDNA3.1 containing CMV promoter and ampicillin resistant gene that had been digested with the same enzyme. The plasmid was then transformed into E.coli JM 2163, and plasmid DNA was subsequently isolated from this strain. Passaging of plasmid DNA via JM 2163 ensures stability of plasmid DNA. Finally the recombinant plasmid pCDNA‐Com‐D was analysed by DNA sequencing and for protein Com‐D expression by Western blotting.

Results:
The S. mutans Com‐D gene was succesfully cloned into the pCDNA3.1 vector and digestion with BamH1 (the cloning sites) confirmed that the new clone, pCDNA3.1 consists of a 1.3 kb of Com‐D DNA fragment. Sequence analysis of the Com‐D coding region in pCDNA‐ComD revealed an identity match of 100% with that of Com‐D DNA sequences from the Gene Bank database.In addition, Western Blot showed the expression of Com‐D protein. Conclusion: We have successfully constructed anti caries pCDNA‐ComD.

[Kembali]